EST details — SGN-E375597

Search information 
Request: 375597Match: SGN-E375597
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180693Clone name: TUS-35-A11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180693 is on microarray TOM1 spot ID 1-1-6.1.17.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34513 [cLEG-31-C21] Trace: SGN-T69309 EST: SGN-E255016 Direction: 5' Facility: TIGR
Clone: SGN-C180693 [TUS-35-A11] Trace: SGN-T187366 EST: SGN-E375598 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E375597Length: 624 bp (939 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E375597 [] (trimmed) ACAACAACTACAAGAGATAATTATATTGAATGTTACTACAACCTAATATTTATGATATACATTTATATCAATACAACAACATTTCTTCTTCCTTT
TTTTCTTCTAATGTATATTGCTATATATATATATATATATATCTTCATTTCATGCTTTATCTTTGAAAAAAGGCAGTTTTTGTAGGAGGCACAAA
AAATTTTGCATATGCAATAGGTAATGCAATCAACTTCTTTGATTTGCTCACATATGCTCTCTTTGTGAAGTTGTTGTAGTCATTGGCTTCAATCT
CATCTAGTATTTTGCGGTACAAGACCAAAGATGCCCATACAGGGAATCTACTAGCTGAGCTCAATTCTGTCACGCCTTTCCTAGTTTTGTTTAAT
TGCATTAGCTATTTTCAATTTTGTTTTGAACATTTTACCAGTCATAGATTTGGCTCCAAAAGCTTTTGTCATGGTTCTCTAGCCTCTTTTGAGGA
TAGTGGAGTTATTGAGCAATTTGGTTTGATCCAAGTTGCTTGATGAGCTGTGACAAAAGCATCTCTGATGCCTTTCTACTTTCTGGTTTTTATAG
CGAATTCCCAGATAAGATGTTGAGACGGTTTTAATATGTTATGCTTTTTAAGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E375597] SGN-U578676 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T187365 [Download][View] Facility Assigned ID: FA0AAD23AA06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0087 Quality Trim Threshold: 12.5