Library Detail Page for TT
| Short Name: | TT |
| Organism: | Nicotiana tabacum |
| Library Name: | Normalized cDNA library constructed from 5 different tissues |
| Total Sequences: | 16068 sequences from 16944 clones |
| Average Sequence Length: | 637.2 (Standard deviation 127.7) |
| Type: | cDNA Library |
| Tissue: | Trichomes and senescent leaf |
| Development Stage: | |
| Treatment Conditions: | |
| Cloning Host: | TransforMax EC100 |
| Cloning Kit: | |
| Comments | 5 different adapter sequences at 5â end to allow unambiguous assignment of the cDNAs within the library to the tissues they are derived from: Samsun trichome (GAATTCGTGAGCCAGAGGACGAGACAATCGAA) Burley trichome (GAATTCGTGAGCCAGAGGACGAGACAAGAGAA) K326 trichome (GAATTCGTGAGCCAGAGGACGAGACAAATGAA) K326 senescent leaf (1) (GAATTCGTGAGCCAGAGGACGAGACAAAGCAA) K326 senescent leaf (4) (GAATTCGTGAGCCAGAGGACGAGACAACGGAA) Adapter sequence at 3â end (Not I site) is 5â-GCGGCCGCTCG(dT25)-3â All clones sequenced 5âto 3â direction only |
| Authors | Jones,L., Yang, A.W. and Coates, S.A. |
| Contact Information | Steve Coates, Advanced Technologies Cambridge, UK |
Working
