EST details — SGN-C10851

Search information 
Request: 10851Match: SGN-C10851
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C10851Clone name: cLEC-6-H14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183901 is on microarray TOM1: SGN-S1-1-6.3.19.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183901 [TUS-43-G3] Trace: SGN-T1792 EST: SGN-E378809 Direction: 5' Facility: Giov. Lab
Clone: SGN-C183901 [TUS-43-G3] Trace: SGN-T196232 EST: SGN-E394906 Direction: 5' Facility: INRA
Clone: SGN-C183901 [TUS-43-G3] Trace: SGN-T199688 EST: SGN-E398362 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202557Length: 566 bp (833 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202557 [] (trimmed) GATTTTTGCCAACTAAAAGGAACAAAAGAATGAAGCAAATTTTCAATGAAGTAAGAACACTGATACTAGAAATTATCAATAAAAGAATGAGGATG
ATTGAAGCTGGAGAATCACATGATGATTTATTGGGTATATTATTGTCATCCAATTTAAAAGAAATTCAACAACATGGGAATAAGAAATTTGGTAT
GAGCATTGATGAGGTGATTGAAGAATGTAAATTGTTTTATTTTGCTGGCCAAGAGACTACTTCAACTTTACTTGTATGGACAATGATTTTACTAA
GCCAACATCCTAATTGGCAAGATAGAGCTAGAGAAGAAGTTTTACAAGTGTTTGGGAGTAATGAAGTTGACTATGACAAGTTGAATCAACTAAAA
GTAGTGACTATGATCTTAAACGAGGTCTTACGATTGTATCCAGCAGGATATATGATGACTAGAATGGTAAAAACAAAAACAAAGTTAGGAAATTT
GTGTTTACCAGGTGGTGTGCAACTTTTGTTACCAACAATATTGTTGCAACATGACACTAAAATATGGGGAGATGATGCAATGGAATTCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202557] SGN-U578818 Tomato 200607 Build 2 80 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24218 [Download] [View] Facility Assigned ID: TCAAX43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.923 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5