EST details — SGN-E304151

Search information 
Request: 304151Match: SGN-E304151
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94910Clone name: cLEX-6-E5
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C185130 is on microarray TOM1: SGN-S1-1-1.2.12.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94910 [cLEX-6-E5] Trace: SGN-T116031 EST: SGN-E304013 Direction: 5' Facility: TIGR
Clone: SGN-C185130 [TUS-46-J8] Trace: SGN-T192018 EST: SGN-E390692 Direction: 5' Facility: INRA
Clone: SGN-C185130 [TUS-46-J8] Trace: SGN-T192267 EST: SGN-E390941 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304151Length: 478 bp (786 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E304151 [] (trimmed) AAAAAATAAATCACCAATCCATTTTTTTAAGTTTATATAATTTCCACCAACTTGGAATGGTTACAAACATAAAAGCATATTATACATAATTTTTC
TAACTAAAACCTACCTACCAAATGAATCTCCCTTTCCTAAAACCTAATCCCAATCTTAATTAAAATTTAAAATTTAAAACTAAAAAAAAGTCAAA
TAAAATAAAATAAAAAATTAAATACCCTCCAAAACTCTAAATTTTGGGGCTATGGAAACCTTTTTTTTCACCAATTAAAAGGTAATTCGGTGTAC
GTCAATTAAATTGACACGTAAGCTGACTCATTTCCCCGTCACATGGGCCACACATGTGGGTCACAAGGCCCAATTTAATGGTCCACACGTGATAC
AACACCCCAAATTCCGACAAAATAACATGGGCCGGGTCAGGCCGGCCTTTTCGCCTAATTTTTTTTTTCGAGTGTCAACAAAAAGTCAAAAATAA
AAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304151] SGN-U582492 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116169 [Download] [View] Facility Assigned ID: TRXAU27TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.893 Expected Error Rate: 0.0125 Quality Trim Threshold: 14.5