EST details — SGN-E395042

Search information 
Request: 395042Match: SGN-E395042
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182824Clone name: TUS-40-J6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182824 is on microarray TOM1 spot ID 1-1-3.2.6.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C134505 [cTOD-9-I22] Trace: SGN-T144054 EST: SGN-E331515 Direction: 5' Facility: TIGR
Clone: SGN-C182824 [TUS-40-J6] Trace: SGN-T196369 EST: SGN-E395043 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395042Length: 522 bp (878 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395042 [] (trimmed) GGGAAAAAAAGGGCCCCCTTTTAAAAATTTTGGGGCAAAGGGGGGGGGTCAAAAAAAAAATTGGGGCCCAACCCCCAACCCCCAATTAAAAAAAA
GGGGGTCCCCCCCCCCTTAAAATAAAAAAGCAAAAAAGGGCCCCCCCGGGGTTTAAAAAAAAAAAAAAAAAAAAAAAAACGGGGGGGGGAAAATA
AAAAAGTGGCAAAAGTTTTGGGGGAAGGGGGCCCCCCGGGGGGAATTTGGGTTAAAAAAAGGGAACCGGGGTTTGCGGGATCCCCCCCCCCCCCC
CAAAAAAAAAAAAAACCCTTTTTGGCCCAAGGGCCCCAGAAAATGGGAATTTTCCCATTTTCCCCCAACCCCCCCCCCGGGGTTTGCCAAAAAAA
CCGGGGAAACCCCTCCAAAAAAAATTTCCTGGGCTTCTTCCAAAAAAAAATTTCCCCCAGAAAAAAGGGGGCCCACCCCCCCCCGGGGGAGAAAA
AAAAATGGGAGGGGCCCCCCCGAAAAATTTAATTTTGCTTCCCCCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395042] SGN-U602805 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196368 [Download][View] Facility Assigned ID: FA0AAD28DE03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.766 Expected Error Rate: 0.0290 Quality Trim Threshold: 14.5