EST details — SGN-E396177

Search information 
Request: 396177Match: SGN-E396177
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174115Clone name: TUS-17-O9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174115 is on microarray TOM1 spot ID 1-1-8.3.17.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7030 [cLEC-37-J17] Trace: SGN-T31239 EST: SGN-E208248 Direction: 5' Facility: TIGR
Clone: SGN-C174115 [TUS-17-O9] Trace: SGN-T1303 EST: SGN-E378157 Direction: 5' Facility: Giov. Lab
Clone: SGN-C174115 [TUS-17-O9] Trace: SGN-T191459 EST: SGN-E390133 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396177Length: 400 bp (913 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396177 [] (trimmed) TGCCACAGCAAAATCTAATTTGTTAATTTTTGTTGATTTTATTTTATTATTATTTTGTGAGAAAATGACTATTCTCATTGAGCAGCCTGAATTTG
GATCACAAGTGGAGGAGAAAAAAGTCTCATTCAATGCCAATGAACTTATTTTGGATGGTGGATTTATGGTACCAAAGACATTGTCTTCTCAAGAT
GAAATATTTGAAGTGCCAGACATAAATGCATTTGGTCAATCATTTAGGGATTATAATGTAGAAAGTGAGAGACAAAAATCAGTGGAAGAATTTTA
TAGGGTTCAACACATTAATCAAACATATGACTATGTGAAAAAAATGAGAAAAGAATATGGAAAATTGAACAAAATTGATATGAGTATTTGGGATT
GTTGTGAACTTTTGAATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396177] SGN-U565448 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197503 [Download][View] Facility Assigned ID: FA0AAD5AH05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0052 Quality Trim Threshold: 20.5