This unigene is from an out-of-date build,
Tomato 200607 #1
It has been superseded by SGN-U578366 in the current build, Tomato 200607 #2
It has been superseded by SGN-U578366 in the current build, Tomato 200607 #2
Unigene Basic Information |
Unigene ID: | SGN-U333715 |
Unigene Build: | Tomato 200607 #1 |
Date: | 2006-07-27 |
Organism: | S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides |
Alternative ID: | 333715 |
mRNA sequence: | Length: 152 bp |
>SGN-U333715 Tomato 200607 #1 (1 members)
ATATAAGAGNGCATCCTTGGATTGGATACATTAATTACTTAATTTTGGGCAATCCAGAAGATGGACAAGTCTAGAGTCACATTACAGGGT
ACATATTTGCCTTGGGTTCATCACTCTCTCCTTCACATACAAACTTTCCATCTTTACCAAAA
[Blast] [AA Translation]
Associated Loci (0) |
Genomic locations (0) |
![]() |
![]() |

To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |