Sol Genomics Network

This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.

Unigene SGN-U208203

Unigene Basic Information

Unigene ID:	SGN-U208203
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	208203
mRNA sequence:	Length: 657 bp

>SGN-U208203 Petunia hybrida #1 (3 members)
GTGTAACCTAGTCCAATGTTTCTCTTCACCCATCAAACATCAGAGTCACTTTCAGGGGTGCTGCAATGGAGTTCCAAAGTGATCTAACAA
GAGAGATCTCTCCACAAAGGAAACTAGGAAGAGGAAAGATTGAGATCAAGAGGATCGAAAACACGACAAATCGGCAAGTCACTTTTTGCA
AGAGACGCAATGGTTTGCTCAAAAAAGCCTATGAATTATCTGTGCTCTGTGATGCTGAAGTTGCTTTGATTGTCTTCTCTAGCCGAGGCA
GGCTCTATGAGTATGCCAACAACAGTGTGAAAGCAACAATTGAGAGGTACAAGAAAGCTTGTTCAGATTCCTCAAACACTGGTTCAATTG
CCGAAGCTAATGCTCAGTATTACCAGCAAGAAGCCTCCAAACTCCGTGCACAAATTGGAAATCTGCAGAACCAGAACAGGAACTTTCTTG
GTGAATCTCTTGCTGCACTGAATCTCAGAGATCTGAGGAACCTGGAACAAAAAATTGAAAAAGGCATTAGCAAAATCCGAGCCAAAAAGA
ATGAGCTGTTGTTTGCTGAAATTGAGTATATGCAAAAGAGGGAAATTGATTTACACAACAACAATCAGTATTTAAGAGCACAGATTGCTG
AAACTGAGAGATCCCAGCAGATGAACT

[Blast] [AA Translation]

Associated Loci (9)

Locus symbol	Locus name	Gene activity
FBP11	floral binding protein 11	transcription factor
pMADS3	floral binding protein 3	transcription factor
FBP6	floral binding protein 6 AY370525	transcription factor
PMADS12	floral binding protein 12
fbp7	floral binding protein 7	transcription factor
FBP23	MADS-box transcription factor 23	transcription factor
FBP22	MADS-box transcription factor 22	transcription factor
AGL6	Agamous-like 6	transcription factor
PETTRNSFB	floral binding protein 2 PETTRNSFB

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-DevA	all floral organs several	2870	3

mRNA member sequences (3)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	41	TF_MADSbox	256
2	22000	TF_MADSbox	192
5	56273	TF_MADSbox	182
1.1	101412	Transcription factor MADS-box - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565)	242
2	118437	Transcription factor MADS-box - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565)	170
5	128950	Transcription factor MADS-box - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565)	149

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Having trouble viewing events on the calendar?
Are you associated with the breeding program you are interested in viewing?

Calendar Permissions

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: