Sol Genomics Network

This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.

Unigene SGN-U209971

Unigene Basic Information

Unigene ID:	SGN-U209971
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	209971
mRNA sequence:	Length: 551 bp

>SGN-U209971 Petunia hybrida #1 (1 members)
AAACTCATTACATACTAGAGAATTATTTCATACCAAAGAGAGAAATATACATTTATTCTCTCTATATAGTATAGTTTATTCTGCACTATA
CTTTTTTGTTAGACAAAAATGGGAAGAGGAAGAGTGCAGATGAAGAGAATTGAGAACAAAATTAATAGACAAGTTACTTTTTCAAAACGT
CGATCTGGATTATTGAAGAAAGCTCATGAGATTTCTGTGCTTTGTGATGCTGAAGTTGGTTTAATTGTTTTTTCTACTAAAGGCAAACTC
TTTGAGTATGCTACTGATTCTTGCATGGAGAGGATTCTTGAAAGATATGAAAGATACTCATATGCTGAAAGGCAGATTGTTTCTACTGAT
CATAGCTCCCCGGGAAGCTGGAATCTGGAACATGCAAAACTTAAGGCCAGAATTGAGGTTTTGCAGAGAAACCAAAGGCATTATATGGGA
GAAGATTTGGACTCGTTAAGTATGAAAGAACTTCAGAATTTGGAGCAACAACTAGATTCTTCTCTTAAACACATTCGATCAAGAAAGAAC
CAATTGATGCA

[Blast] [AA Translation]

Associated Loci (12)

Locus symbol	Locus name	Gene activity
PMADS9	floral binding protein 9 AY370510	transcription factor
PFG	floral binding protein PFG	transcription factor
PMADS12	floral binding protein 12
FRUITFULL-like	floral binding protein 26
PhFL	FRUITFULL-like
PhSEP1	SEPALLATA1-like
FBP29	MADS-box transcription factor 29	transcription factor
FBP23	MADS-box transcription factor 23	transcription factor
FBP22	MADS-box transcription factor 22	transcription factor
FBP4	MADS-box transcription factor 4	transcription factor
AGL6	Agamous-like 6	transcription factor
PETTRNSFB	floral binding protein 2 PETTRNSFB

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	cPHA	stamens stamens from open flowers on 18-20 week old plants	6801	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E530340
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	41	TF_MADSbox	256
2	22000	TF_MADSbox	192
5	56273	TF_MADSbox	182
1.1	101412	Transcription factor MADS-box - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565)	242
2	118437	Transcription factor MADS-box - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565)	170
5	128950	Transcription factor MADS-box - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565)	149

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Having trouble viewing events on the calendar?
Are you associated with the breeding program you are interested in viewing?

Calendar Permissions

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: