Sol Genomics Network

This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U579808 in the current build, Tomato 200607 #2

Unigene SGN-U313114

Unigene Basic Information

Unigene ID:	SGN-U313114
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	313114
mRNA sequence:	Length: 1208 bp

>SGN-U313114 Tomato 200607 #1 (66 members)
TAGGGTTTCTCTTCCGCAGCTTCTCTAGCCTCGCCTCATCCATCCCCTTCCCCCAAACCCCCCCCAAAGCAGAGCAAATCTCTTCTTTCC
AACATGGCCGTCGGCAAGAACAAGAGGATTTCCAAGGGAAAGAAGGGAGGAAAGAAGAAGGCGGCGGATCCCTACGCAAAGAAGGACTGG
TATGACATCAAGGCACCATCTGTTTTTGAAATTAAGAACGTCGGCAAAACCCTTGTTACCAGGACTCAGGGTACCAAGATTGCTTCAGAG
GGTCTAAAACACAGAGTATTTGAAGTTAGCCTGGCTGATCTTCAGAAGGATGAGGATCAGGCTTTCAGGAAAATCCGTTTGAGAGCAGAA
GATGTGCAAGGGAGGAATGTTCTCACAAACTTCCATGGAATGGATTTCACAACAGATAAGCTGAGGTCTCTGGTCCGCAAATGGCAGACT
TTGATTGAGGCCCATGTTGATGTCAAGACTACAGACAGCTATACTCTAAGGATGTTCTGTATTGCTTTTACAAAGAAGCGTCCAAACCAA
CAGAAGCGTACCTGCTATGCCCAGAGCAGCCAGATCCGTCAGATCCGCAGGAAGATGGTTGAGATCATGAGGAACCAAGCCAGTTCCTGT
GACTTGAAGGAGTTAGTTGCAAAATTCATCCCCGAATCAATTGGCAGGGAGATTGAGAAAGCAACTTCCAGCATCTTCCCCCTACAAAAT
GTCTATATTCGAAAGGTCAAGATCCTCAAGGCCCCTAAATTTGACCTTGGCAAGCTGATGGAGGTTCATGGTGACTATTCAGAAGATGTT
GGTGTGAAGTTGGATCGGCCAGCTGATGAGACAGTAGCTGAGGCAGAGGCCGAGGTTCCTGGATCTTAGACTTGTTTCATCCATCGAGTT
ACGTTACCCAATATGGTGGTAGTCTTTAGAGCATCACATTGTTTAAGTTGAGTTTTGTTGTGACATCTGAAAATTTTGCATCTGGTTCTT
TGCCTATGTTTTATCCATACATTATCATAGACCAAGATATGGATTTTCCAGCTGTTTTATCTATTACTAATTTCTTTCCCGTATGTTGAA
TTATGTCATTGTGGAACTTGGTAATTCATGCTTTTTTGTAAAGCTTCGCAGGAGATTCATTTCTCTTTGTGCTTGCCTTTTCATCTTTGG
TGAAACCATATGTTTTAAGGTGAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (20)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	19
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1
Solanum lycopersicum	LA	Leaf Mature leaves	6589	4
Solanum lycopersicum	LB	Leaf Mature leaves	3316	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	2
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	1
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	2
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	2
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	3
Solanum lycopersicum	cLER	leaf 4 weeks	5127	4
Solanum lycopersicum	cLES	leaf 4 weeks	5243	4
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	1
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	2
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	1
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	4
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	5
Solanum lycopersicum	cTOS	suspension cultures	8026	5
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	2

mRNA member sequences (66)

Alignment image suppressed for unigene with 66 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	102043	Ribosomal protein S3Ae - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	24
2	118973	Ribosomal protein S3Ae - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	24
5	129358	Ribosomal protein S3Ae - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	24

Preceding Unigenes (1)

Unigene	Build
SGN-U212980	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Having trouble viewing events on the calendar?
Are you associated with the breeding program you are interested in viewing?

Calendar Permissions

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: