Sol Genomics Network

This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been split into SGN-U577270, SGN-U577731, SGN-U578689, and SGN-U580246 in the current build, Tomato 200607 #2

Unigene SGN-U314700

Unigene Basic Information

Unigene ID:	SGN-U314700
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	314700
mRNA sequence:	Length: 962 bp

>SGN-U314700 Tomato 200607 #1 (895 members)
AACATATCAAAAACCTTATCATTTCATTATATAAAAGGATAGTGGACATCAAAAGGTTCATATTGAACCAAAAAAAGAGAGAAGAAGCAA
TATGGCTTCCTCTGTCATTTCTTCAGCAGCTGTTGCCACACGCAGCAATGTTACACAAGCTAGCATGGTTGCACCTTTCACTGGTCTCAA
ATCTTCAGCCACTTTCCCTGTTACAAAGAAGCAAAACCTTGACATCACTTCCATTGCTAGCAATGGTGGAAGAGTTAGCTGCATGCAGGT
GTGGCCACCAATTAACATGAAGAAGTACGAGACACTCTCATACCTTCCTGATTTGTCTGACGAGCAATTGCTTAGTGAAATTGAGTACCT
TTTGAAAAATGGATGGGTTCCTTGCTTGGAATTTGAGACTGAGCACGGATTTGTCTACCGTGAGAACAACAAGTCACCAGGATACTATGA
TGGAAGGTACTGGACCATGTGGAAGTTGCCTATGTTTGGGTGCACTGATGCAACCCAAGTGTTGGCTGAGGTTCAAGAGGCTAAAAAGGC
ATACCCACAAGCATGGGTCAGAATCATTGGATTCGACAATGTGCGTCAAGTGCAGTGTATCAGTTTCATTGCCTACAAGCCAGAAGGCTA
CTAAGTTTCATATTAGGAACAAAATTGTCTTTAGGGACACTTTGTTTTTAAATGCTACTTAGGTCTTTTTTCTTTTTTGTCTTAATTCCA
ACAAACTCTTTGTGTCTTGTACTATTCGGTTTATGTTTTGGATTTATGAGTACCTAATTATATGATAATGATTTGGTGCTTTGTTTGTAA
AAAAAAAAAAAAATGGTTTATATGACTTTTTGTGTTTTATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGGGGGCCCCCCCCCCCCCCCCCC

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
ss5	Tomato RuBP carboxylase small subunit

Genomic locations (0)

None

Library representation (29)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	5
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	13
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	3
Solanum lycopersicum	LA	Leaf Mature leaves	6589	7
Solanum lycopersicum	LB	Leaf Mature leaves	3316	17
Solanum lycopersicum	LC	Leaf Mature leaves	5712	21
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	26
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	3
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	19
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	9
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	5
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	9
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	8
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	90
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	5
Solanum lycopersicum	cLER	leaf 4 weeks	5127	92
Solanum lycopersicum	cLES	leaf 4 weeks	5243	54
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	293
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	19
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	54
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	24
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	1
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	96
Solanum lycopersicum	cTSB	seed	1880	6
Solanum lycopersicum	cTSD	seed	1504	1
Solanum lycopersicum	t3_tus	Rearrayed collection of L. esculentum cDNA clones	1883	1
Solanum lycopersicum	vSlycmRNA		8362	2
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	10
Solanum habrochaites	cLHT	leaf trichomes 4-8 weeks old	2457	2

mRNA member sequences (895)

Alignment image suppressed for unigene with 895 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (11)

Annotations (manual: 2 | blast: 2 | go: 3 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101403	Dehydrin - Biological Process: response to stress (GO:0006950) - Biological Process: response to water (GO:0009415) Haloacid dehalogenase-like hydrolase - Molecular Function: catalytic activity (GO:0003824) - Biological Process: metabolism (GO:0008152)	270
2	118508	Ribulose bisphosphate carboxylase small chain - Cellular Component: ribulose bisphosphate carboxylase complex (sensu Magnoliophyta) (GO:0009573) - Biological Process: carbon utilization by fixation of carbon dioxide (GO:0015977) - Molecular Function: ribulose-bisphosphate carboxylase activity (GO:0016984)	74
5	129006	Ribulose bisphosphate carboxylase small chain - Cellular Component: ribulose bisphosphate carboxylase complex (sensu Magnoliophyta) (GO:0009573) - Biological Process: carbon utilization by fixation of carbon dioxide (GO:0015977) - Molecular Function: ribulose-bisphosphate carboxylase activity (GO:0016984)	70

Preceding Unigenes (2)

Unigene	Build
SGN-U225512	Lycopersicon Combined #3
SGN-U235362	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Having trouble viewing events on the calendar?
Are you associated with the breeding program you are interested in viewing?

Calendar Permissions

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: